C52 aptamer

•



Timeline

1996

Aptamers were found to be functionally equivalent to the RBE when the assay system was saturated with Rev and better than the wild-type element when Rev was limiting[1]

1996

Using the SELEX method, Ellington, A. D. and colleagues obtained a series of anti-peptide aptamers that can recognize amino acid sequences[2]

1996

HIV-1 17-mer rev peptide and RNA aptamer complex formation involves adaptive binding with the alpha-helical arginine-rich basic rev peptide targeting a widened RNA major groove centred about adjacent G.A and reversed A.A mismatches[3]

1998

Specific inhibition of viral p24 production following co-transfection of the anti-HIV Rev-binding aptamer and HIV proviral DNAs was observed[4]

2004

More than half of the residues have increased flexibility in the Rev-RNA aptamer complex that has a higher affinity. This further suggests that the retention of conformational flexibility may be important in high-affinity ARM-RNA recognition[5]

2018

Wingfield, P. T. et al. present the crystal structure of Rev93:scFv:RBA-14 Ternary Complex at 3.0 Å through X-ray[6]

Description

In 1996, Ellington, A. D. and colleagues used the SELEX method to isolate the anti-peptide aptamers with high affinity for the HIV-1 Rev protein. HIV-1 Rev protein were selected from a random sequence RNA pool. Several of the selected RNAs could bind the free peptide more tightly than a natural RNA ligand, the Rev-binding element. In accord with the hypothesis that protein and nucleic acid binding cusps are functionally similar, interactions between aptamers and the peptide target could be disrupted by sequence substitutions. Moreover, the aptamers appeared to be able to bind peptides with different solution conformations, implying an induced fit mechanism for binding. Just as anti-peptide antibodies can sometimes recognize the corresponding epitope when presented in a protein, the anti-peptide aptamers were found to specifically bind to Rev[2].



SELEX

In 1996, Ellington, A. D. and colleagues used existing research to design the method required for the SELEX process. The RNA recognition domain of HIV-1 Rev is an ARM that spans residues 34-50. A 17-mer peptide (sRev) corresponding to this domain was used as a target for in vitro selection experiments. A RNA pool containing 71 random sequence positions was incubated with an affinity resin containing sRev[2].

Detailed information are accessible on SELEX page.



Structure

C52 was the aptamer sequence mainly studied in the article, which had a high affinity with HIV-1 Rev protein. The 2D structure of the figures is based on the prediction results of the RNA fold website by ribodraw tool to draw. The C52 aptamer was named by Ellington, A. D. et al. in the article[2].

5'-GGGAGAUACCAGCUUAUUCAAUUGCUUGGUACCGAGCUCGGAUCCACGUAGUAACGGGCCGCCAGUGUCUGGAAUUCGGGUCGUUCUUGAGAUAGUAAGUGCAAUCU-3'

drawing


Ligand information

SELEX ligand

REV is a viral anti-repression trans-activator protein, which appears to act post-transcriptionally to relieve negative repression of GAG and ENV production. It is a phosphoprotein whose state of phosphorylation is mediated by a specific serine kinase activity present in the nucleus. REV accumulates in the nucleoli.-----From Pfam

UniProt ID: uniquely identifies protein sequences in the UniProt database, a resource for protein information.

Pfam: a widely recognised database of protein families and domains.

GenBank: maintained by NCBI(National Center for Biotechnology Information), is a database of nucleotide sequences from various organisms, vital for genetic and molecular biology research.

Mass: an intrinsic property of a body.

Name Uniprot ID Pfam Mass Protein sequence PDB ID GenBank
HIV-1 Rev protein P04616 PF00424 3.22 kDa
...... GAMATRQARRNRRRRWRERQRAAAAR (residues 34-50)
2M1A AAA44200.1

Some isolated sequences bind to the affinity of the protein[2].

Name Sequence Ligand Affinity
C52 5'-GGGAGAUACCAGCUUAUUCAAUUGCUUGGUACCGAGCUCGGAUCCACGUAGUAACGGGCCGCCAGUGUCUGGAAUUCGGGUCGUUCUUGAGAUAGUAAGUGCAAUCU-3' HIV-1 Rev protein 19-36 nM
C17 5'-GGGAGAUACCAGCUUAUUCAAUUGUAUUCUCCGUGGUUUAAUCAGAGUAGAGGAGCUGACUCCUUUGGUUGGACUACGUGGAGGUGCUCUUAGAUAGUAAGUGCAAUCU-3' HIV-1 Rev protein 19-36 nM
C8 5'-GGGAGAUACCAGCUUAUUCAAUUGAGCCAGUAAGUGACCCGUACUAAUACUGUUGAGUAGUAUGUAGAGGAGUGGUGAUCCUCCAAACUGCUGAGAUAGUAAGUGCAAUCU-3' HIV-1 Rev protein 19-36 nM
drawing

Similar compound(s)

We used the RCSB PDB website's similar structure search to find the top 10 structures similar to HIV-1 REV PROTEIN (residues T34-R50), and calculated TM-socre values and RMSD values using the TM-align website.

Z-score: a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious.

RMSD: (Root Mean Square Deviation) is used to measure the degree to which atoms deviate from the alignment position.

PDB: PDB ID+ chain name.

PDB TM-socre RMSD (Å) Description
2LD2 0.358 0.89 Solution structure of the N-terminal domain of huntingtin (htt17) in presence of DPC micelles
1DNG 0.442 1.68 NMR structure of a model hydrophilic amphipathic helical acidic peptide
3N95-E 0.034 1.7 Crystal structure of human CRFR2 alpha extracellular domain in complex with Urocortin 2
1OMQ 0.366 1.1 Structure of penetratin in bicellar solution
7LSO 0.44 0.67 L-Phenylseptin
2RLG 0.34 0.79 NMR structure of the antimicrobial peptide RP-1 bound to SDS micelles
3N93-E 0.03 1.62 Crystal structure of human CRFR2 alpha extracellular domain in complex with Urocortin 3
7LSP 0.465 0.56 D-Phenylseptin - The second residue of PHE of the peptide is a D-amino acid
1O53 0.371 0.49 Solution structure of the N-terminal membrane anchor of E. coli enzyme IIA(Glucose)
6GS9 0.303 1.36 NMR structure of aurein 2.5 in SDS micelles


References

[1] RNA aptamers selected to bind human immunodeficiency virus type 1 Rev in vitro are Rev responsive in vivo.
Symensma, T. L., Giver, L., Zapp, M., Takle, G. B., & Ellington, A. D.
Journal of virology, 70(1), 179–187. (1996)
[2] Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope.
Xu, W., & Ellington, A. D.
Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. (1996)
[3] Deep penetration of an alpha-helix into a widened RNA major groove in the HIV-1 rev peptide-RNA aptamer complex.
Ye, X., Gorin, A., Ellington, A. D., & Patel, D. J.
Nature structural biology, 3(12), 1026–1033. (1996)
[4] Receptor ligand-facilitated cationic liposome delivery of anti-HIV-1 Rev-binding aptamer and ribozyme DNAs.
Konopka, K., Düzgüneş, N., Rossi, J., & Lee, N. S.
Journal of drug targeting, 5(4), 247–259. (1998)
[5] Retention of conformational flexibility in HIV-1 Rev-RNA complexes.
Wilkinson, T. A., Zhu, L., Hu, W., & Chen, Y.
Biochemistry, 43(51), 16153–16160. (2004)
[6] Structure of an RNA Aptamer that Can Inhibit HIV-1 by Blocking Rev-Cognate RNA (RRE) Binding and Rev-Rev Association.
Dearborn, A. D., Eren, E., Watts, N. R., Palmer, I. W., Kaufman, J. D., Steven, A. C., & Wingfield, P. T.
Structure (London, England : 1993), 26(9), 1187–1195.e4. (2018)