Doxycyline aptamer
Description
In 2000, Piganeau and Jenne isolated RNA binding to some dyes through in vitro selection experiments. And they applied a novel in vitro selection strategy based on allosteric inhibition of a hammerhead ribozyme fused to a randomized RNA library by low concentrations of the antibiotic doxycycline. Selection for allosteric inhibition led to 10–50-fold responses, at nanomolar concentrations of a nontoxic, cell-permeable molecule of low molecular weight. When inserted into the mRNA of a certain target gene, allosteric molecular switches of this type may serve as a valuable tool for the development of tailored conditional gene expression systems that can be controlled by the presence or absence of any kind of small molecule[1].SELEX
Piganeau, N., Jenne, A., Thuillier, V., & Famulok, M. Eight different sequences were obtained from isolation of doxycycline-conjugated RNA using an in vitro selection system, and the selected pool was cloned and sequenced after rounds 10, 13 and 16[1].
Detailed information are accessible on SELEX page.
Structure
The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. In addition, an analytical affinity column was run under isocratic conditions to determine an approximate dissociation constant (Kd) for the RNA-ligand interaction. The 2D structure of the left figure(1D16-05) is based on the article, and the right figure(1D16-13) is based on the prediction results of the RNA fold website. We used the minimum free energy (MFE) structure.1D16-05 aptamer and 1D16-13 aptamer binding to Doxycyline.1D16-05 aptamer: 5'-GGAGCUCGGUAGUGACGCGUUGUGUUUACGCGUCUGAUGAGUGGUACAGUCCAGGGUGAAGUUCCAAUUUUGAACACCUCCACGAAACUACCUCGAGACGU-3'
1D16-13 aptamer: 5'-GGAGCUCGGUAGUGACGCGUUGUGUUUACGCGUCUGAUGAGUCCUCGGUAAUCGCCGUAUCAAAAGUCGGAAUGGAGGGUCGACGAAACUACCUCGAGACGU-3'
|
|
Ligand information
SELEX ligand
Doxycycline is a tetracycline antibiotic used to treat a wide variety of bacterial infections.-----From Drugbank
Name | Molecular Formula | MW | CAS | Solubility | PubChem | Drug ID |
---|---|---|---|---|---|---|
Doxycyline | C22H24N2O8 | 444.4 g/mol | 564-25-0 | 50 mg/ml | 54671203 | DB00254 |
Similar compound
We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.
Zinc_id | Named | CAS | Pubchem CID | Structure |
---|---|---|---|---|
ZINC252586752 | (4R,4aR,5R,5aR,6S,12aR)-4-(dimethylamino)-1,5,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-4a,5,5a,6-tetrahydro-4H-tetracene-2-carboxamide | NA | 124080906 | |
ZINC100302140 | Doxycycline,(S) | NA | 54741563 | |
ZINC198855020 | 6-Epidoxycycline | 3219-99-6 | 54685534 | |
ZINC198589814 | (4S,4aR,5S,5aR,6R,12aS)-4-(dimethylamino)-1,5,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-4a,5,5a,6-tetrahydro-4H-tetracene-2-carboxamide | NA | 73950444 | |
ZINC198796850 | (4R,4aS,5R,5aS,6R,12aS)-4-(dimethylamino)-1,5,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-4a,5,5a,6-tetrahydro-4H-tetracene-2-carboxamide | NA | 54748199 | |
ZINC100302137 | Doxycycline | 564-25-0 | 54671203 |
References
[1] An Allosteric Ribozyme Regulated by Doxycyline.Piganeau, N., Jenne, A., Thuillier, V., & Famulok, M.
Angewandte Chemie (International ed. in English), 39(23), 4369–4373. (2000)