Home
Database
Research
About us
GRK2 aptamer
Description
In 2008, Mayer, G.et al. have used SELEX (systematic evolution of ligands by exponential enrichment) to develop RNA aptamers that potently and selectively inhibit GRK2. This process has yielded an aptamer, C13, which bound to GRK2 with a high affinity. In 2012, Tesmer, J. J. determined crystallographic structures of GRK2 bound to an RNA aptamer that potently and selectively inhibits kinase activity[1,2].SELEX
In 2008, Mayer, G.et al. used a structurally constrained RNA library in vitro selection. After 12 selection cycles the enriched RNA library was analyzed for GRK2 binding. The enriched RNA library was cloned and the sequences of 18 monoclones were determined[1].
Detailed information are accessible on SELEX page.
Structure
2D representation
Here we use ribodraw to complete the figure, through the 3D structure information[2].
C13.18 aptamer: 5'-GGCAGACCAUACGGGAGAGAAACUUGCC-3'
C13.28 aptamer: 5‘-CCAUACGGGAGAGAAACU-3’
|
|
3D visualisation
Mayer, G., & Tesmer, J. J. determined the crystal structure of C13.18 aptamer bound to the GRK2 protein at 3.51 Å resolution and C13.28 aptamer bound to the GRK2 protein at 4.52 Å resolution. The PDB ID of the two aptamers are 3UZT and 3UZS[2]. Only the structure of 3ZUS is shown here.Additional available structures that have been solved and detailed information are accessible on Structures page.
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
Binding pocket
Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 3UZS at 4.52 Å resolution. The GRK2 protein (shown in vacuumm electrostatics), blue is positive charge, red is negative charge. Right: The hydrogen bonds of binding sites of the aptamer bound with the GRK2 protein. Hydrogen bonds was predicted by Pymol.
|
|
Ligand information
SELEX ligand
Used a flow cytometry-based protein-RNA interaction assay. Biotinylated GRK2 (bGRK2) was first immobilized on streptavidin beads and incubated with increasing amounts of 5'Alexa Fluor-488-labeled C13.28 (F-C13.28) or C13.18 (F-C13.18). The beads were then passed through a flow cytometer and the amount of bead-bound fluorescence was quantitated to yield a dissociation constant (Kd)[2].| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| C13.18 | CCAUACGGGAGAGAAACU | GRK2 | 35 ± 5 nM |
| C13.20 | GACCAUACGGGAGAGAAACU | GRK2 | 48 ± 7 nM |
| C13.28 | GGCAGACCAUACGGGAGAGAAACUUGCC | GRK2 | 1.2 ± 0.6 nM |
Structure ligand
GRK2, also called beta-adrenergic receptor kinase (beta-ARK) or beta-ARK1, is important in regulating several cardiac receptor responses. It plays a role in cardiac development and in hypertension. Deletion of GRK2 in mice results in embryonic lethality, caused by hypoplasia of the ventricular myocardium. GRK2 also plays important roles in the liver (as a regulator of portal blood pressure), in immune cells, and in the nervous system. Altered GRK2 expression has been reported in several disorders including major depression, schizophrenia, bipolar disorder, and Parkinsonism. GRK2 contains an N-terminal RGS homology (RH) domain, a central catalytic domain, and C-terminal pleckstrin homology (PH) domain that mediates PIP2 and G protein betagamma-subunit translocation to the membrane. GRKs phosphorylate and regulate G protein-coupled receptors (GPCRs), the largest superfamily of cell surface receptors which regulate some part of nearly all physiological functions. Phosphorylated GPCRs bind to arrestins, which prevents further G protein signaling despite the presence of activating ligand. TheGRK2 subfamily is part of a larger superfamily that includes the catalytic domains of other STKs, protein tyrosine kinases, RIO kinases, aminoglycoside phosphotransferase, choline kinase, and phosphoinositide 3-kinase.-----Interpro
| Uniprot ID | InterPro ID | MW | Amino acids sequences | PDB ID | GenBank |
|---|---|---|---|---|---|
| P21146 | CD14223/ | 79.66 KDa | MADLEAVLADVSYLMAMEKSKATPAARASKKILLPEPSIRSVMQKYLEDRGEVTFEKIFSQKLGYLLFRDFCLKHLEEAKPLVEFYEEIKKYEKLETEEERLVCSREIFDTYIMKELLACSHPFSKSAIEHVQGHLVKKQVPPDLFQPYIEEICQNLRGDVFQKFIESDKFTRFCQWKNVELNIHLTMNDFSVHRIIGRGGFGEVYGCRKADTGKMYAMKCLDKKRIKMKQGETLALNERIMLSLVSTGDCPFIVCMSYAFHTPDKLSFILDLMNGGDLHYHLSQHGVFSEADMRFYAAEIILGLEHMHNRFVVYRDLKPANILLDEHGHVRISDLGLACDFSKKKPHASVGTHGYMAPEVLQKGVAYDSSADWFSLGCMLFKLLRGHSPFRQHKTKDKHEIDRMTLTMAVELPDSFSPELRSLLEGLLQRDVNRRLGCLGRGAQEVKESPFFRSLDWQMVFLQKYPPPLIPPRGEVNAADAFDIGSFDEEDTKGIKLLDSDQELYRNFPLTISERWQQEVAETVFDTINAETDRLEARKKTKNKQLGHEEDYALGKDCIMHGYMSKMGNPFLTQWQRRYFYLFPNRLEWRGEGEAPQSLLTMEEIQSVEETQIKERKCLLLKIRGGKQFVLQCDSDPELVQWKKELRDAYREAQQLVQRVPKMKNKPRSPVVELSKVPLIQRGSANGL | 1OMW | 282682 |
 |
Similar compound
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation. The Dali server is a network service for comparing protein structures in 3D. Dali compares them against those in the Protein Data Bank (PDB). Z-score is a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious. RMSD(Root Mean Square Deviation) value is used to measure the degree to which atoms deviate from the alignment position.
| PDB | Z-score | RMSD | Description |
|---|---|---|---|
| 1OMW-A | 55.2 | 0 | G-protein coupled receptor kinase 2 |
| 3PSC-A | 51.8 | 0.4 | Beta-adrenergic receptor kinase 1 |
| 3PVW-A | 50.3 | 0.7 | Beta-adrenergic receptor kinase 1 |
| 7PWD-A | 49.5 | 1.3 | Beta-adrenergic receptor kinase 1 |
| 1YM7-A | 49.1 | 0.8 | Beta-adrenergic receptor kinase 1 |
| 1YM7-D | 49 | 0.6 | Beta-adrenergic receptor kinase 1 |
| 3PVU-A | 48.8 | 0.5 | Beta-adrenergic receptor kinase 1 |
| 5UKL-A | 48.7 | 1.2 | Beta-adrenergic receptor kinase 1 |
| 3CIK-A | 48.4 | 1.2 | Beta-adrenergic receptor kinase 1 |
| 6U7C-A | 48.3 | 0.9 | Beta-adrenergic receptor kinase 1 |
References
[1] An RNA molecule that specifically inhibits G-protein-coupled receptor kinase 2 in vitro.Mayer, G., Wulffen, B., Huber, C., Brockmann, J., Flicke, B., Neumann, L., Hafenbradl, D., Klebl, B. M., Lohse, M. J., Krasel, C., & Blind, M.
RNA (New York, N.Y.), 14(3), 524–534. (2008)
[2] Molecular mechanism for inhibition of g protein-coupled receptor kinase 2 by a selective RNA aptamer.
Tesmer, V. M., Lennarz, S., Mayer, G., & Tesmer, J. J.
Structure (London, England : 1993), 20(8), 1300–1309. (2012)
[3] Crystallographic Pursuit of a Protein-RNA Aptamer Complex.
Tesmer J. J.
Methods in molecular biology (Clifton, N.J.), 1380, 151–160. (2016)