HIV-1 Rev protein_59 aptamer
Description
In 1993, Lori Giver and colleagues used the SELEX method to isolate the aptamer with high affinity for the HIV-1 Rev protein. It can competitively bind Rev protein with RRE, thereby preventing RRE from interacting with Rev protein. Refer to the RBA-14 aptamer page for specific aptamer[1].</p>SELEX
In 1993, Lori Giver et al. constructed a pool of random sequences. After in vitro selecting in the pool, selected RNAs were amplified via reverse transcription, polymerase chain reaction (PCR) amplification, in vitro T7 transcription, and allowed to again compete for binding to Rev. Some aptamers with high affinity were selected after three selection cycles[1].
Structure
59 was the aptamer sequence mainly studied in the article, which had a high affinity with HIV-1 Rev protein. The 2D structure of the figure is based on the prediction results of the RNA fold website by ribodraw tool to draw[1].
5'-AUUCUGGCUUCGUACGCAAGUAUGAUGAUACAG-3'
Ligand information
SELEX ligand
REV is a viral anti-repression trans-activator protein, which appears to act post-transcriptionally to relieve negative repression of GAG and ENV production. It is a phosphoprotein whose state of phosphorylation is mediated by a specific serine kinase activity present in the nucleus. REV accumulates in the nucleoli.-----From Pfam
Name | Uniprot ID | Pfam | MW | Amino acids sequences | PDB | Gene ID |
---|---|---|---|---|---|---|
HIV-1 Rev protein | P04325 | PF00424 | 2.4 kDa | TRQARRNRARRWRARQR(residue 34-50) | 1RPV | AAA45000.1 |
Some isolated sequences bind to the affinity of the protein.
Name | Sequence | Ligand | Affinity |
---|---|---|---|
sequence 59 | AUUCUGGCUUCGUACGCAAGUAUGAUGAUACAG | HIV-1 Rev protein | 0.2* |
sequence 72 | AUUCUGUAUGAGAGUAGCAAGUACCGGACUCUACAG | HIV-1 Rev protein | 0.3* |
sequence 50 | AUUCUGGUCUCGUACGCAAGUACUGAGAAACGACAG | HIV-1 Rev protein | 0.4* |
References
[1] Selective optimization of the Rev-binding element of HIV-1.Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D.
Nucleic acids research, 21(23), 5509–5516. (1993)
[2] Selection and design of high-affinity RNA ligands for HIV-1 Rev.
Giver, L., Bartel, D. P., Zapp, M. L., Green, M. R., & Ellington, A. D.
Gene, 137(1), 19–24. (1993)
[3] A three-dimensional model of the Rev-binding element of HIV-1 derived from analyses of aptamers.
Leclerc, F., Cedergren, R., & Ellington, A. D.
Nature structural biology, 1(5), 293–300. (1994)
[4] RNA aptamers selected to bind human immunodeficiency virus type 1 Rev in vitro are Rev responsive in vivo.
Symensma, T. L., Giver, L., Zapp, M., Takle, G. B., & Ellington, A. D.
Journal of virology, 70(1), 179–187. (1996)
[5] Receptor ligand-facilitated cationic liposome delivery of anti-HIV-1 Rev-binding aptamer and ribozyme DNAs.
Konopka, K., Düzgüneş, N., Rossi, J., & Lee, N. S.
Journal of drug targeting, 5(4), 247–259. (1998)
[6] Retention of conformational flexibility in HIV-1 Rev-RNA complexes.
Wilkinson, T. A., Zhu, L., Hu, W., & Chen, Y.
Biochemistry, 43(51), 16153–16160. (2004)
[7] Structure of an RNA Aptamer that Can Inhibit HIV-1 by Blocking Rev-Cognate RNA (RRE) Binding and Rev-Rev Association.
Dearborn, A. D., Eren, E., Watts, N. R., Palmer, I. W., Kaufman, J. D., Steven, A. C., & Wingfield, P. T.
Structure (London, England : 1993), 26(9), 1187–1195.e4. (2018)