Description

In 1995, Yu Tian and colleagues used the SELEX method to isolate the aptamer with high affinity for the HTLV-1 Tax protein. It prevents the Tax protein from forming complexes with cellular transcription factors, thereby exerting its inhibitory effect[1].

SELEX

In 1995, Yu Tian et al. started from a pool of greater than 1013 different RNAs with a core of 120 random sequence positions. After five cycles of selection and amplification, a single nucleic acid species remained. This aptamer was found to bind Tax with high affinity and specificity[1].


Structure

YT1 was the aptamer sequence mainly studied in the article, which had a high affinity with HTLV-1 Tax protein. The 2D structure of the figure is based on the article by ribodraw tool to draw[1].

5'-GGGAGAAUUCCGACCAGAAGCUUGGACUUAUUCUCGAGCCUGCAUGUGCUAGUCGACGUUGUUUCUGCAUCUUGAAAGAUGGGGCUGUGGGUGUGGUUACUUCUACGCGGUAUGCACUGUACGCCAUCCAUAUGUGCGUCUACAUGGAUCCUCA-3'

drawing

Ligand information

SELEX ligand

Tax is a transcriptional activator. Its ability to modulate the expression and function of many cellular genes has been reasoned to be a major contributory mechanism explaining HTLV-I-mediated transformation of cells. In activating cellular gene expression, Tax impinges upon several cellular signal-transduction pathways, including those for CREB/ATF and NF-kappaB.-----From Pfam

Name Uniprot ID Pfam MW Amino acids sequences PDB Gene ID
HTLV-1 Tax protein P14079 PF02959 1.04 kDa KHFRETEV 7QRS 1491938

Some isolated sequences bind to the affinity of the protein.

Name Sequence Ligand Affinity
YT1 GGGAGAAUUCCGACCAGAAGCUUGGACUUAUUCUCGAGCCUGCAUGUGCUAGUCGACGUUGUUUCUGCAUCUUGAAAGAUGGGGCUGUGGGUGUGGUUACUUCUACGCGGUAUGCACUGUACGCCAUCCAUAUGUGCGUCUACAUGGAUCCUCA HTLV-1 Tax protein 70 nM
drawing

Similar compound

Due to the lack of complete or large fragments of the protein structure, no similar compounds have been listed in this part.

References

[1] Dissecting protein:protein interactions between transcription factors with an RNA aptamer.
Tian, Y., Adya, N., Wagner, S., Giam, C. Z., Green, M. R., & Ellington, A. D.
RNA (New York, N.Y.), 1(3), 317–326. (1995)