HTLV-1 Tax protein_YT1 aptamer
Description
In 1995, Yu Tian and colleagues used the SELEX method to isolate the aptamer with high affinity for the HTLV-1 Tax protein. It prevents the Tax protein from forming complexes with cellular transcription factors, thereby exerting its inhibitory effect[1].
SELEX
In 1995, Yu Tian et al. started from a pool of greater than 1013 different RNAs with a core of 120 random sequence positions. After five cycles of selection and amplification, a single nucleic acid species remained. This aptamer was found to bind Tax with high affinity and specificity[1].
Structure
YT1 was the aptamer sequence mainly studied in the article, which had a high affinity with HTLV-1 Tax protein. The 2D structure of the figure is based on the article by ribodraw tool to draw[1].
5'-GGGAGAAUUCCGACCAGAAGCUUGGACUUAUUCUCGAGCCUGCAUGUGCUAGUCGACGUUGUUUCUGCAUCUUGAAAGAUGGGGCUGUGGGUGUGGUUACUUCUACGCGGUAUGCACUGUACGCCAUCCAUAUGUGCGUCUACAUGGAUCCUCA-3'
Ligand information
SELEX ligand
Tax is a transcriptional activator. Its ability to modulate the expression and function of many cellular genes has been reasoned to be a major contributory mechanism explaining HTLV-I-mediated transformation of cells. In activating cellular gene expression, Tax impinges upon several cellular signal-transduction pathways, including those for CREB/ATF and NF-kappaB.-----From Pfam
| Name | Uniprot ID | Pfam | MW | Amino acids sequences | PDB | Gene ID |
|---|---|---|---|---|---|---|
| HTLV-1 Tax protein | P14079 | PF02959 | 1.04 kDa | KHFRETEV | 7QRS | 1491938 |
Some isolated sequences bind to the affinity of the protein.
| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| YT1 | GGGAGAAUUCCGACCAGAAGCUUGGACUUAUUCUCGAGCCUGCAUGUGCUAGUCGACGUUGUUUCUGCAUCUUGAAAGAUGGGGCUGUGGGUGUGGUUACUUCUACGCGGUAUGCACUGUACGCCAUCCAUAUGUGCGUCUACAUGGAUCCUCA | HTLV-1 Tax protein | 70 nM |
Similar compound
Due to the lack of complete or large fragments of the protein structure, no similar compounds have been listed in this part.
References
[1] Dissecting protein:protein interactions between transcription factors with an RNA aptamer.Tian, Y., Adya, N., Wagner, S., Giam, C. Z., Green, M. R., & Ellington, A. D.
RNA (New York, N.Y.), 1(3), 317–326. (1995)