J6f1 aptamer

•

横向排列的点击按钮

Description

 In 1995, Wang & Rando reported on the selection of RNA aptamers which were directed against the aminoglycoside tobramycin. In 1998, Hamasaki and Rando were reported here which are designed to reveal the nature of the tobramycin binding domain of J6. Experiments are reported here which are designed to reveal the nature of the tobramycin binding domain of J6. A small (40 nts) stem-loop derivative of J6, containing a 3 nt and a 1 nt bulge, stoichiometrically binds tobramycin with a dissociation constant of approximately 5 nM. These studies demonstrate that simplified RNA molecules can be generated which bind aminoglycosides specifically and with high affinities. J6f1 is a truncated mutant of J6 aptamer[1].

SELEX

Hamasaki and his colleagues truncated J6 and screened it for transcription to find that J6f1 was the sequence with the highest affinity for tobramycin[1].
Detailed information are accessible on SELEX page.



Structure

The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. In addition, an analytical affinity column was run under isocratic conditions to determine an approximate dissociation constant (Kd) for the RNA-ligand interaction. The 2D structure of the figures is based on the prediction results of the RNA fold website by ribodraw tool to draw.

J6: 5'-GGGAGAAUUCCGACCAGAAGCUUAGUAUAGCGAGGUUUAGCUACACUCGUGCUGAUCGUUUGGUACGGGACCUGCGUGUAGCCCAUAUGUGCGUCUACAUGGAUCCUCA-3'
J6f1: 5'-GGCUUAGUAUAGCGAGGUUUAGCUACACUCGUGCUGAGCC-3'
drawing drawing


Ligand information

SELEX ligand

Tobramycin is an aminoglycoside antibiotic used to treat cystic fibrosis-associated bacterial, lower respiratory tract, urinary tract, eye, skin, bone, and skin structure infections.-----From Drugbank

Name Molecular Formula MW CAS Solubility PubChem Drug ID
Tobramycin C18H37N5O9 467.5 g/mol 32986-56-4 5.37e+01 g/L 36294 DB00684
drawing


Similar compound

We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.
Zinc_id Named CAS Pubchem CID Structure
ZINC8551162 (2R,3S,4R,5S,6S)-4-amino-2-[(1R,2R,3R,4S,6R)-4,6-diamino-3-[(2S,3S,5S,6S)-3-amino-6-(aminomethyl)-5-hydroxyoxan-2-yl]oxy-2-hydroxycyclohexyl]oxy-6-(hydroxymethyl)oxane-3,5-dio NA 92331686 drawing
ZINC8551164 (2R,3S,4R,5S,6S)-4-amino-2-[(1R,2R,3R,4S,6R)-4,6-diamino-3-[(2R,3S,5S,6S)-3-amino-6-(aminomethyl)-5-hydroxyoxan-2-yl]oxy-2-hydroxycyclohexyl]oxy-6-(hydroxymethyl)oxane-3,5-diol NA 92331688 drawing
ZINC8551165 (2R,3S,4R,5S,6S)-4-amino-2-[(1R,2R,3R,4S,6R)-4,6-diamino-3-[(2R,3S,5S,6R)-3-amino-6-(aminomethyl)-5-hydroxyoxan-2-yl]oxy-2-hydroxycyclohexyl]oxy-6-(hydroxymethyl)oxane-3,5-diol NA 92331689 drawing
ZINC8551163 (2R,3S,4R,5S,6S)-4-amino-2-[(1R,2R,3R,4S,6R)-4,6-diamino-3-[(2S,3S,5S,6R)-3-amino-6-(aminomethyl)-5-hydroxyoxan-2-yl]oxy-2-hydroxycyclohexyl]oxy-6-(hydroxymethyl)oxane-3,5-diol NA 92331687 drawing
ZINC43562055 (2S,3R,4R,5S,6S)-2-(Aminomethyl)-6-[(1R,2R,3S,4R,6S)-4,6-diamino-3-[(2S,3R,4S,5S,6R)-4-amino-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-hydroxycyclohexyl]oxyoxane-3,4,5-triol NA 11274101 drawing
ZINC8214590 Kanamycin 59-01-8 6032 drawing
ZINC53132258 Bekanamycin 4696-76-8 439318 drawing
ZINC8214383 Dibekacin 34493-98-6 470999 drawing


References

[1] Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities.
Hamasaki, K., Killian, J., Cho, J., & Rando, R. R.
Biochemistry, 37(2), 656–663. (1998)