Home
Database
Research
About us
Spinach aptamer
Timeline
A new class of biosensors on the basis of Spinach to detect metabolites and proteins both in vitro and in living bacteria[2]
A simple, robust, and universal system consisting of the EGFP-like Spinach aptamer and a highly active hammerhead ribozyme for monitoring and quantifying the synthesis of any RNA in real time[3]
Illumination of the Spinach-fluorogen complex induces photoconversion and subsequently fluorogen dissociation which leading to fast fluorescence decay and fluorogen-concentration-dependent recovery was reported[4]
The structural features that are required for fluorophore binding to Spinach2, and novel fluorophores that bound and be switched to a fluorescent state by Spinach2 were described[5]
The Spinach aptamer sequence was used as a tool to characterize mRNA expression in Escherichia coli[6]
The fluorescent RNA aptamer Spinach was re-engineered to be activated in a sequence-dependent manner[8]
A platform for rapid generation of highly fluorescent RNA–fluorophore complexes that are optimized for function in cells[9]
The bifurcation of the preexisting Spinach aptamer was present, and its utility as a novel split aptamer system for monitoring RNA self-assembly was demonstrated[10]
A natural threeway junction structure to generate an alternative scaffold that enables stable aptamer expression in cells and markedly enhanced the brightness of mammalian cells expressing tagged RNAs[11]
Spinach riboswitches, a novel class of genetically encoded metabolite sensor based on Spinach RNA aptamer[12]
Tandem arrays containing multiple Spinach aptamers were constructed and tested to increase the brightness of these aptamer-fluorogen systems[13]
The isolation of an order of magnitude times brighter mutants of the light-up RNA aptamers Spinach that are far less salt-sensitive and higher thermal stability[14]
Split spinach aptamer probes for fluorescent analysis of nucleic acids were designed and tested[15]
A study of the performance of distinct RNA Spinach and Broccoli aptamer sequences in isolation or inserted into the small subunit of the bacterial ribosome[16]
An RNA aptamer-based FRET system which placed Spinach and Mango in close proximity on the RNA scaffolds using single-stranded RNA origami scaffolds[17]
A label-free and low-background fluorescent assay, termed amplified tandem Spinach-based aptamer transcription assay for highly sensitive miRNA detection[18]
It is indicated that if the isomerization of Spinach is impeded, the fluorescence signal is enhanced significantly[19]
Description
In a work published in 2011, Jeremy S. Paige et al. isolated an RNA aptamer, named Spinach, which binds DFHBI and enhances its optical properties. Later, in a work published in 2014 by Katherine Deigan Warner and others, the structure of the Spinach-DFHBI complex was analyzed by crystallization, diffraction data collection, structure determination and refinement[1,7].SELEX
SELEX was performed with a library containing ~5×1013 RNA molecules and selected RNAs for their ability to bind DMHBI-agarose. The selection process went through 10 rounds. After SELEX, researchers selected a number of sequences, including Spinach, to characterize their affinity for the dye and its spectral properties[7].
Detailed information are accessible on SELEX page.
Structure
2D representation
Here we used Ribodraw to complete the figure, through the 3D structure information[1].
5'-GACGCGACUGAAUGAAAUGGUGAAGGACGGGUCCAGGUGUGGCUGCUUCGGCAGUGCAGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUAGUCGCGUC-3'
3D visualisation
Katherine Deigan Warner et al. present the solution structure, as determined by multidimensional NMR spectroscopy, molecular dynamics calculations, crystallization and diffraction data collection of Spinach–DFHBI complex. The PDB ID of these structures are 4TS0 and 4TS2[7].Additional available structures that have been solved and detailed information are accessible on Structures page.
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
Binding pocket
Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 4TS0 by NMR and X-ray crystallography. DFHBI (shown in sticks) is labeled in yellow. Right: The hydrogen bonds of binding sites of the aptamer bound with DFHBI or other nucleotides surround small molecules.
|
|
Ligand information
SELEX ligand
The Kd was determined by measuring the increase in fluorescence as a function of increasing fluorophore concentration in the presence of a fixed concentration of RNA aptamer[1].
Structure ligand
DFHBI is a small molecule that resembles the chromophore of green fluorescent protein. Spinach and DFHBI are essentially nonfluorescent when unbound, whereas the Spinach-DFHBI complex is brightly fluorescent both in vitro and in living cells.-----From MedChemExpress
| PubChem CID | Molecular Formula | MW | CAS | Solubility | MedChemExpress |
|---|---|---|---|---|---|
| 70808995 | C12H10F2N2O2 | 252.22 g/mol | 1241390-29-3 | ≥ 83.33 mg/mL in DMSO | HY-110250 |
 |
 |
Similar compound
We screened the compounds with great similarity to DFHBI by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID.
| Zinc_id | Named | CAS | Pubchem CID | Structure |
|---|---|---|---|---|
| ZINC98208026 | NA | NA | 131633007 |  |
| ZINC33551210 | NA | NA | 124391872 |  |
| ZINC8091529 | NA | NA | 19374978 |  |
| ZINC409189401 | NA | NA | 126195641 |  |
| ZINC409190392 | NA | NA | 126196630 |  |
| ZINC408820263 | NA | NA | 125827993 |  |
| ZINC408816652 | NA | NA | 125824383 |  |
| ZINC408846725 | NA | NA | 125854305 |  |
| ZINC255720511 | NA | NA | NA |  |
References
[1] RNA mimics of green fluorescent protein.Paige, J. S., Wu, K. Y., & Jaffrey, S. R.
Science (New York, N.Y.), 333(6042), 642–646. (2011)
[2] New approaches for sensing metabolites and proteins in live cells using RNA.
Strack, R. L., & Jaffrey, S. R.
Current opinion in chemical biology, 17(4), 651–655. (2013)
[3] Universal aptamer-based real-time monitoring of enzymatic RNA synthesis.
Höfer, K., Langejürgen, L. V., & Jäschke, A.
Journal of the American Chemical Society, 135(37), 13692–13694. (2013)
[4] Understanding the photophysics of the spinach-DFHBI RNA aptamer-fluorogen complex to improve live-cell RNA imaging.
Han, K. Y., Leslie, B. J., Fei, J., Zhang, J., & Ha, T.
Journal of the American Chemical Society, 135(50), 19033–19038. (2013)
[5] Plug-and-play fluorophores extend the spectral properties of Spinach.
Song, W., Strack, R. L., Svensen, N., & Jaffrey, S. R.
Journal of the American Chemical Society, 136(4), 1198–1201. (2014)
[6] The spinach RNA aptamer as a characterization tool for synthetic biology.
Pothoulakis, G., Ceroni, F., Reeve, B., & Ellis, T.
ACS synthetic biology, 3(3), 182–187. (2014)
[7] Structural basis for activity of highly efficient RNA mimics of green fluorescent protein.
Warner, K. D., Chen, M. C., Song, W., Strack, R. L., Thorn, A., Jaffrey, S. R., & Ferré-D'Amaré, A. R.
Nature structural & molecular biology, 21(8), 658–663. (2014)
[8] A Spinach molecular beacon triggered by strand displacement.
Bhadra, S., & Ellington, A. D.
RNA (New York, N.Y.), 20(8), 1183–1194. (2014)
[9] Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution.
Filonov, G. S., Moon, J. D., Svensen, N., & Jaffrey, S. R.
Journal of the American Chemical Society, 136(46), 16299–16308. (2014)
[10] Fluorescent monitoring of RNA assembly and processing using the split-Spinach aptamer.
Rogers, T. A., Andrews, G. E., Jaeger, L., & Grabow, W. W.
ACS synthetic biology, 4(2), 162–166. (2015)
[11] In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies.
Filonov, G. S., Kam, C. W., Song, W., & Jaffrey, S. R.
Chemistry & biology, 22(5), 649–660. (2015)
[12] Imaging metabolite dynamics in living cells using a Spinach-based riboswitch.
You, M., Litke, J. L., & Jaffrey, S. R.
Proceedings of the National Academy of Sciences of the United States of America, 112(21), E2756–E2765. (2015)
[13] Tandem spinach array for mRNA imaging in living bacterial cells.
Zhang, J., Fei, J., Leslie, B. J., Han, K. Y., Kuhlman, T. E., & Ha, T.
Scientific reports, 5, 17295. (2015)
[14] iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications.
Autour, A., Westhof, E., & Ryckelynck, M.
Nucleic acids research, 44(6), 2491–2500. (2016)
[15] Split spinach aptamer for highly selective recognition of DNA and RNA at ambient temperatures.
Kikuchi, N., & Kolpashchikov, D. M.
Chembiochem : a European journal of chemical biology, 17(17), 1589–1592. (2016)
[16] Use of Baby Spinach and broccoli for imaging of structured cellular RNAs.
Okuda, M., Fourmy, D., & Yoshizawa, S.
Nucleic acids research, 45(3), 1404–1415. (2017)
[17] Development of a genetically encodable FRET system using fluorescent RNA aptamers.
Jepsen, M. D. E., Sparvath, S. M., Nielsen, T. B., Langvad, A. H., Grossi, G., Gothelf, K. V., & Andersen, E. S.
Nature communications, 9(1), 18. (2018)
[18] Amplified tandem Spinach-based aptamer transcription enables low background miRNA detection.
Tang, X., Deng, R., Sun, Y., Ren, X., Zhou, M., & Li, J. (2018).
Analytical chemistry, 90(16), 10001–10008. (2018)
[19] Characterization of the photophysical behavior of DFHBI derivatives: Fluorogenic molecules that illuminate the Spinach RNA aptamer.
Santra, K., Geraskin, I., Nilsen-Hamilton, M., Kraus, G. A., & Petrich, J. W.
The journal of physical chemistry. B, 123(11), 2536–2545. (2019)
[20] Photophysics of DFHBI bound to RNA aptamer Baby Spinach.
Dao, N. T., Haselsberger, R., Khuc, M. T., Phan, A. T., Voityuk, A. A., & Michel-Beyerle, M. E.
Scientific reports, 11(1), 7356. (2021)