Timeline

Lee SY et.al isolated aptamers that bind to TCF-1 with high affinity and specificity[1]

Lee SK et.al selected an RNA aptamer that specifically bound to the beta-catenin-interacting N-terminal motif of TCF-1[2]

Park MW et.al selected an RNA aptamer that binds to the DNA binding domain of TCF-1[3]

Choi KH et.al had developed the RNA expression vector for stable expression of RNA aptamer inside of the mammalian cells[4]

Description

In 2004, Lee S.Y and Jeong S. screened an RNA library consisting of random sequences of 70 nucleotides and were able to isolate aptamers that bind to TCF-1 with high affinity and specificity. And employed RNase footprinting to characterize the RNA structures and map their binding sites for TCF-1. In 2006,Choi K.H. et al. have selected previously an RNA aptamer that binds to the DNA-binding domain of TCF-1 and have shown that it interfered with binding of TCF-1 to its specific DNA recognition sequences in vitro[1].

SELEX

In 2004, Lee SY and colleagues used existing research to design the method required for the in vitro genetic-selection. Starting from a RNA pool that had a sequence of 70 random nucleotide positions, aptamers that bind specifically to RANK were selected after 13 rounds of selection and amplification. The aptamer, #10, can bind specifically to TCF-1 were selected with high affinity[1].


Structure

The 2D structure of the figure is based on the article by ribodraw tool to draw[1].

5'-GGGGAGCUCGGUACCGGUGCGAUCCCCUGUUUACAUUGCAUGCUAGGACGACGCGCCCGAGCGGGUACCCAUUGUGUCGUCGGAAGCUUUGCAGAGGAUC-3'

drawing

Ligand information

SELEX ligand

The TCF7-like family includes TCF-7, TCF7-like 1 (TF7L1), lymphoid enhancer-binding factor 1 (LEF-1), and similar proteins. TCF-7, also called T-cell-specific transcription factor 1, or T-cell factor 1 (TCF-1), is a T lymphocyte-specific transcriptional activator involved in T-cell lymphocyte differentiation.-----From Pfam

Name Uniprot ID Pfam MW Amino acids sequences PDB Gene ID
TCF-1 P36402 CD21996 41.642 kDa MPQLDSGGGGAGGGDDLGAPDELLAFQDEGEEQDDKSRDSAAGPERDLAELKSSLVNESEGAAGGAGIPGVPGAGAGARGEAEALGREHAAQRLFPDKLPEPLEDGLKAPECTSGMYKETVYSAFNLLMHYPPPSGAGQHPQPQPPLHKANQPPHGVPQLSLYEHFNSPHPTPAPADISQKQVHRPLQTPDLSGFYSLTSGSMGQLPHTVSWFTHPSLMLGSGVPGHPAAIPHPAIVPPSGKQELQPFDRNLKTQAESKAEKEAKKPTIKKPLNAFMLYMKEMRAKVIAECTLKESAAINQILGRRWHALSREEQAKYYELARKERQLHMQLYPGWSARDNYGKKKRRSREKHQESTTETNWPRELKDGNGQESLSMSSSSSPA NA 6932

The aptamer bind to the affinity of the ligand.

Name Sequence Ligand Affinity
#10 5'-GGGGAGCUCGGUACCGGUGCGAUCCCCUGUUUACAUUGCAUGCUAGGACGACGCGCCCGAGCGGGUACCCAUUGUGUCGUCGGAAGCUUUGCAGAGGAUC-3' TCF-1 125 ± 25 nM

References

[1] In vitro selection and characterization of TCF-1 binding RNA aptamers.
Lee SY, Jeong S.
Mol Cells. 17(1):174-9. (2004)
[2] An RNA aptamer that binds to the beta-catenin interaction domain of TCF-1 protein.
Lee SK, Park MW, Yang EG, Yu J, Jeong S.
Biochem Biophys Res Commun. 327(1):294-9. (2005)
[3] Inhibition of the DNA binding by the TCF-1 binding RNA aptamer.
Park MW, Choi KH, Jeong S.
Biochem Biophys Res Commun. 330(1):11-7. (2005)
[4] Intracellular expression of the T-cell factor-1 RNA aptamer as an intramer.
Choi KH, Park MW, Lee SY, Jeon MY, Kim MY, Lee HK, Yu J, Kim HJ, Han K, Lee H, Park K, Park WJ, Jeong S.
Mol Cancer Ther. 2006 Sep;5(9):2428-34. (2006)