Home
Database
Research
About us
TetR aptamer
Timeline
The TetR-binding RNA aptamer was identified by a combination of in vitro selection for TetR binding and an in vivo screening for aptamer activity via a transcription reporter assay[1]
Description
In 2009, Anke Hunsicker et al. identified an RNA aptamer by in vitro screening for TetR binding and in vivo screening for TetR inducible binding that induces ter controlled gene expression in E. coli. In 2020, Florian C. Grau et al. presented the crystal structure of the TetR-RNA aptamer complex at 2.7 Å resolution[1,5].SELEX
In 2009, Anke Hunsicker et al. isolated sequences that bind TetR through 12 rounds of selection[1].
Detailed information are accessible on SELEX page.
Structure
2D representation
Here we use ribodraw to complete the figure, through the 3D structure information. TetR-aptamer was the aptamer sequence mainly studied in SELEX article[5].
5'-GGCCGGAGAAUGUUAUGGCGCGAAAGCGCAGAGAAAACCGGUC-3'
3D visualisation
Florian C. Grau1 et al. sovled the crystal structure, at 2.7 A resolution, of an RNA aptamer bound to the transcription repressor TetR has been determined. The PDB ID of this structure is 6SY4 and 6SY6[5].Additional available structures that have been solved and detailed information are accessible on Structures page.
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
Binding pocket
Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 6SY4 and 6SY6 at 2.7 Å resolution. TetR (shown in vacuumm electrostatics), blue is positive charge, red is negative charge. Right: The hydrogen bonds of binding sites of the aptamer bound with TetR.
|
|
Ligand information
SELEX ligand
Florian C. Grau et al. investigated the affinity of the RNA aptamer via EMSA and ITC experiments[5].| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| TetR–RNA aptamer K1 | GGCCGGAGAAUGUUAUGGCGCGAAAGCGCAGAGAAAACCGGUC | TetR | 80 nM |
Structure ligand
TetR family regulators are involved in the transcriptional control of multidrug efflux pumps, pathways for the biosynthesis of antibiotics, response to osmotic stress and toxic chemicals, control of catabolic pathways, differentiation processes, and pathogenicity. The TetR proteins identified in over 115 genera of bacteria and archaea share a common helix-turn-helix (HTH) structure in their DNA-binding domain. However, TetR proteins can work in different ways: they can bind a target operator directly to exert their effect (e.g. TetR binds Tet(A) gene to repress it in the absence of tetracycline), or they can be involved in complex regulatory cascades in which the TetR protein can either be modulated by another regulator or TetR can trigger the cellular response. This entry represents the tetracycline transcriptional repressor TetR, which binds to the Tet(A) gene to repress its expression in the absence of tetracycline.-----from Pfam
| Uniprot ID | Pfam | MW | Amino acids sequences | PDB ID | GenBank |
|---|---|---|---|---|---|
| P04483 | IPR003012 | 46.51 kDa | SRLNRESVIDAALELLNETGIDGLTTRKLAQKLGIEQPTLYWHVKNKRALLDALAVEILARHHDYSLPAAGESWQSFLRNNAMSFRRALLRYRDGAKVHLGTRPDEKQYDTVETQLRFMTENGFSLRDGLYAISAVSHFTLGAVLEQQEHTAALTDRPAAPDENLPPLLREALQIMDSDDGEQAFLHGLESLIRGFEVQLTALLQIVSRLNRESVIDAALELLNETGIDGLTTRKLAQKLGIEQPTLYWHVKNKRALLDALAVEILARHHDYSLPAAGESWQSFLRNNAMSFRRALLRYRDGAKVHLGTRPDEKQYDTVETQLRFMTENGFSLRDGLYAISAVSHFTLGAVLEQQEHTAALTDRPAAPDENLPPLLREALQIMDSDDGEQAFLHGLESLIRGFEVQLTALLQIV | 4V2F | 912848 |
 |
Similar compound
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation. The Dali server is a network service for comparing protein structures in 3D. Dali compares them against those in the Protein Data Bank (PDB). Z-score is a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious. RMSD(Root Mean Square Deviation) value is used to measure the degree to which atoms deviate from the alignment position.
| PDB | Z-score | RMSD | Description |
|---|---|---|---|
| 3ZQG-A | 25 | 1.1 | Tracycline repressor protein class b from trans |
| 3BQY-A | 19.6 | 2 | Putative tetr family transcriptional regulator |
| 1Z0X-A | 18.1 | 2.3 | Transcriptional regulator,tetr family |
| 2HXO-A | 15 | 3.1 | Putative tetr-family transcriptional regulator |
| 2Y31-A | 15 | 3.1 | Putative repressor simreg2 |
| 2HXI-B | 14.9 | 3.3 | Putative transcriptional regulator |
| 1ZK8-A | 14.6 | 2.8 | Transcriptional regulator,tetr family |
| 2NP5-A | 13.1 | 2.9 | Transcriptional regulator |
| 2ZCX-A | 12.9 | 3.5 | Tetr-family transcriptional regulator |
| 3ON2-B | 12.4 | 3.3 | Probable transcriptional regulator |
References
[1] An RNA aptamer that induces transcription.Hunsicker, A., Steber, M., Mayer, G., Meitert, J., Klotzsche, M., Blind, M., Hillen, W., Berens, C., & Suess, B.
Chemistry & biology, 16(2), 173–180. (2009)
[2] Mechanistic basis for RNA aptamer-based induction of TetR.
Steber, M., Arora, A., Hofmann, J., Brutschy, B., & Suess, B.
Chembiochem : a European journal of chemical biology, 12(17), 2608–2614. (2011)
[3] Design and implementation of a synthetic pre-miR switch for controlling miRNA biogenesis in mammals.
Atanasov, J., Groher, F., Weigand, J. E., & Suess, B.
Nucleic acids research, 45(22), e181. (2017)
[4] Robust gene expression control in human cells with a novel universal TetR aptamer splicing module.
Mol, A. A., Groher, F., Schreiber, B., Rühmkorff, C., & Suess, B.
Nucleic acids research, 47(20), e132. (2019)
[5] The complex formed between a synthetic RNA aptamer and the transcription repressor TetR is a structural and functional twin of the operator DNA-TetR regulator complex.
Grau, F. C., Jaeger, J., Groher, F., Suess, B., & Muller, Y. A.
Nucleic acids research, 48(6), 3366–3378. (2020)
[6] Inducible nuclear import by TetR aptamer-controlled 3' splice site selection.
Mol, A. A., Vogel, M., & Suess, B.
RNA (New York, N.Y.), 27(2), 234–241. (2021)