Home
Database
Research
About us
Thrombin aptamer
Timeline
Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to isolate from a population of 10(13) RNA molecules of high affinity RNAs that bind specifically to human alpha-thrombin in the first time[1]
Describe an in vitro selection strategy in which RNA ligands (aptamers) that bind both human and porcine thrombin were selected by “toggling” the protein target between human and porcine thrombin during alternating rounds of selection[2]
Showed that protein-binding oligonucleotides (aptamers) against coagulation factor IXa are potent anticoagulants[3]
Reported the isolation of aptamers specific for bovine thrombin by systematic evolution of ligands by exponential enrichment (SELEX) from an RNA pool[4]
Suggested that the primary effect of aptamer binding was through the heparin-binding site of thrombin, anion-binding exosite-2 (exosite-2)[5]
A crystal structure of an RNA aptamer bound to human thrombin, a protein that does not naturally bind nucleic acid, at 1.9 A resolution[6]
Description
In 1994, Kubik, M F et al. ystematic Evolution of Ligands by Exponential enrichment (SELEX) was used to isolate from a population of 1013 RNA molecules two classes of high affinity RNAs that bind specifically to human α-thrombin. In 2001, Rebekah R White and Bruce A Sullenger obtained human and porcine thrombin RNA aptamers by alternating rounds of selection. In 2008, Long, Stephen B et al.present a crystal structure of an RNA aptamer bound to human thrombin, a protein that does not naturally bind nucleic acid, diffracted X-rays to 1.9 Å resolution[1,2,6].SELEX
In 2001，In this study, Rebekah R White and Bruce A Sullenger conducted a rigorous screening process on a library comprising approximately 1014 distinct RNA sequences to identify molecules exhibiting binding affinity towards both human and porcine thrombin. The initial round of in vitro selection involved incubating the RNA library with both human and porcine thrombin (FIIa). Subsequently, in the second round of selection, the enriched RNA library was exposed solely to human FIIa, and RNA molecules bound to this protein were recovered. In the third round, the human-centric RNA library was subjected to incubation with porcine FIIa, and the subset of RNAs demonstrating binding affinity towards the porcine protein was isolated. This iterative process led to the development of a refined library enriched with RNA sequences exhibiting conserved binding motifs between the FIIa homologues. This "toggle" selection strategy was replicated in rounds 4–13 of SELEX, alternating between human and porcine proteins in even and odd rounds, respectively. Simultaneously, 13 rounds of standard SELEX were conducted individually against human and porcine proteins for comparative analysis[2].
Detailed information are accessible on SELEX page.
Structure
2D representation
Here we use ribodraw to complete the figure, through the 3D structure information. Toggle-25t aptamer was the aptamer sequence mainly studied in SELEX article. fC/fU: 2′-F substituents. se: 2′-SeMe substituents. Fs2: 3′-phosphate replaced by a PS2 moiety[6,7].
5'-GGGAACAAAGCUGAAGUACUUACCC-3'
|
|
3D visualisation
Long, Stephen B et al. determined the crystal structure of Toggle-25t aptamer bound to α-thrombin at 1.9 Å resolution. The PDB ID of this structure is 3DO2. Abeydeera, N Dinuka et al. determined the crystal structure of Toggle-25t aptamer bound to α-thrombin at 1.86 Å resolution. The PDB ID of this structure is 5DO4. Here only the structural diagram of 3DD2 is shown. There is no obvious difference between the structures of 5DO4 and 3DD2[6,7].Additional available structures that have been solved and detailed information are accessible on Structures page.
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
Binding pocket
Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 3DD2 at 1.90 Å resolution. Human thrombin protein (shown in vacuumm electrostatics), blue is positive charge, red is negative charge. Right: The hydrogen bonds of binding sites of the aptamer bound with human thrombin protein.
|
|
Ligand information
SELEX ligand
Rebekah R White and Bruce A Sullenger determined Toggle-25t RNA aptamer–protein equilibrium dissociation constants (Kd‘s) by the double-filter, nitrocellulose-filter binding method as described. Abeydeera ND and Egli M et al. The binding affinities of select AF113-18 aptamer and their library variants were determined by biolayer interferometry (BLI) on a fortéBIO Octet Red96 instrument (Pall fortéBIO) at 30 °C[2,7].| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| Toggle-25t RNA aptamer | GGGAACAAAGCUGAAGUACUUACCC | Huamn Thrombin | 0.54 ± 0.1 nM |
| AF113-18 aptamer | GGGAACAAAGCUGAAGU(PS2 substitution)ACUUACCC | Huamn Thrombin | 1.8 ± 0.2 pM |
Structure ligand
Thrombin is a serine peptidase belonging to MEROPS peptidase family S1 (chymotrypsin family, clan PA(S)), subfamily S1A. Thrombin, which has also been called fibrinogenase and factor IIa, is the final proteinase in the vertebrate blood coagulation cascade. Thrombin triggers clotting by releasing fibrinopeptides A and B from the amino ends of fibrinogen a and b chains. Thrombin has been identified in hagfish as well as in vertebrates. Following the signal sequence, thrombin contains one vitamin K-dependent carboxylation/gamma-carboxyglutamic (GLA) domain, two kringle domains, and a trypsin domain.-----from Pfam
| Uniprot ID | Pfam | MW | Amino acids sequences | PDB ID | GenBank |
|---|---|---|---|---|---|
| P00734 | PIRSF001149 | 43.28 kDa | MAHVRGLQLPGCLALAALCSLVHSQHVFLAPQQARSLLQRVRRANTFLEEVRKGNLERECVEETCSYEEAFEALESSTATDVFWAKYTACETARTPRDKLAACLEGNCAEGLGTNYRGHVNITRSGIECQLWRSRYPHKPEINSTTHPGADLQENFCRNPDSSTTGPWCYTTDPTVRRQECSIPVCGQDQVTVAMTPRSEGSSVNLSPPLEQCVPDRGQQYQGRLAVTTHGLPCLAWASAQAKALSKHQDFNSAVQLVENFCRNPDGDEEGVWCYVAGKPGDFGYCDLNYCEEAVEEETGDGLDEDSDRAIEGRTATSEYQTFFNPRTFGSGEADCGLRPLFEKKSLEDKTERELLESYIDGRIVEGSDAEIGMSPWQVMLFRKSPQELLCGASLISDRWVLTAAHCLLYPPWDKNFTENDLLVRIGKHSRTRYERNIEKISMLEKIYIHPRYNWRENLDRDIALMKLKKPVAFSDYIHPVCLPDRETAASLLQAGYKGRVTGWGNLKETWTANVGKGQPSVLQVVNLPIVERPVCKDSTRIRITDNMFCAGYKPDEGKRGDACEGDSGGPFVMKSPFNNRWYQMGIVSWGEGCDRDGKYGFYTHVFRLKKWIQKVIDQFGE | 1PPB | M17262.1 |
 |
Similar compound
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation. The Dali server is a network service for comparing protein structures in 3D. Dali compares them against those in the Protein Data Bank (PDB). Z-score is a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious. RMSD(Root Mean Square Deviation) value is used to measure the degree to which atoms deviate from the alignment position.
| PDB | Z-score | RMSD | Description |
|---|---|---|---|
| 1PPB | 51.1 | 0 | Alpha-thrombin (small subunit) |
| 5E8E-H | 48.2 | 0.3 | IGa Fab light chain |
| 3QLP-H | 48.2 | 0.3 | Thrombin heavy chain |
| 6EVV-H | 48.1 | 0.3 | Prothrombin |
| 3PMH-B | 48 | 0.3 | Thrombin alpha-chain |
| 8BW5-H | 48 | 0.3 | Thrombin light chain |
| 1OOK-B | 47.9 | 0.3 | Human alpha thrombin |
| 4LZ4-B | 47.9 | 0.5 | Thrombin light chain |
| 6GN7-H | 47.8 | 0.5 | Prothrombin |
| 4LZ4-D | 47.7 | 0.5 | Thrombin light chain |
References
[1] High-affinity RNA ligands to human alpha-thrombin.Kubik, M. F., Stephens, A. W., Schneider, D., Marlar, R. A., & Tasset, D.
Nucleic acids research, 22(13), 2619–2626. (1994)
[2] Generation of species cross-reactive aptamers using "toggle" SELEX.
White, R., Rusconi, C., Scardino, E., Wolberg, A., Lawson, J., Hoffman, M., & Sullenger, B.
Molecular therapy : the journal of the American Society of Gene Therapy, 4(6), 567–573. (2001)
[3] RNA aptamers as reversible antagonists of coagulation factor IXa.
Rusconi, C. P., Scardino, E., Layzer, J., Pitoc, G. A., Ortel, T. L., Monroe, D., & Sullenger, B. A.
Nature, 419(6902), 90–94. (2002)
[4] RNA aptamers specific for bovine thrombin.
Liu, X., Zhang, D., Cao, G., Yang, G., Ding, H., Liu, G., Fan, M., Shen, B., & Shao, N.
Journal of molecular recognition : JMR, 16(1), 23–27. (2003)
[5] RNA aptamer to thrombin binds anion-binding exosite-2 and alters protease inhibition by heparin-binding serpins.
Jeter, M. L., Ly, L. V., Fortenberry, Y. M., Whinna, H. C., White, R. R., Rusconi, C. P., Sullenger, B. A., & Church, F. C.
JFEBS letters, 568(1-3), 10–14. (2004)
[6] Crystal structure of an RNA aptamer bound to thrombin.
Long, S. B., Long, M. B., White, R. R., & Sullenger, B. A.
RNA (New York, N.Y.), 14(12), 2504–2512. (2008)
[7] Evoking picomolar binding in RNA by a single phosphorodithioate linkage.
Abeydeera, N. D., Egli, M., Cox, N., Mercier, K., Conde, J. N., Pallan, P. S., Mizurini, D. M., Sierant, M., Hibti, F. E., Hassell, T., Wang, T., Liu, F. W., Liu, H. M., Martinez, C., Sood, A. K., Lybrand, T. P., Frydman, C., Monteiro, R. Q., Gomer, R. H., Nawrot, B., … Yang, X
Nucleic acids research, 44(17), 8052–8064. (2016)