Description

In 1999, Tocchini-Valentini, G. P. and colleagues employed in vitro selection to identify RNA sequences that bind with high affinity to a T7 transcript corresponding to phenylalanine tRNA of Saccharomyces cerevisiae. Six RNA aptamers that bind to yeast phenylalanine tRNA were identified by in vitro selection from a random-sequence pool. The two most abundantly represented aptamers interact with the tRNA anticodon loop, each through a sequence block with perfect Watson-Crick complementarity to the loop. It was possible to truncate one of these aptamers to a simple hairpin loop that forms a classical 'kissing complex' with the anticodon loop. Three other aptamers had nearly complete complementarity to the anticodon loop. The sixth aptamer had two sequence blocks, one complementary to the tRNA T loop and the other to the D loop; this aptamer binds better to a mutant tRNA that disrupts the normal D-loop/T-loop tertiary interaction than to the wild-type tRNA. Selection of complements to tRNA loops occurred despite an attempt to direct binding to tertiary structural features of tRNA. This serves as a reminder of how special the RNA-RNA interactions were that were not based on complementarity.^[1].

SELEX

In 1999, Tocchini-Valentini, G. P. and colleagues used a pool with an 80 nucleotide (nt) region of fully random sequence to isolate aptamers that can bind to yeast phenylalanine tRNA. Selection was performed using a phenylalanine tRNA affinity matrix containing 3 mM tRNA. Detailed information are accessible on SELEX page.^[1].

Structure

2D representation

B2 was the aptamer sequence mainly studied in the article, which had a high affinity with yeast phenylalanine tRNA. The 2D structure of the figure is based on the prediction results of the RNA fold website by ribodraw tool to draw. The B2 aptamer was named by Tocchini-Valentini, G. P. et al. in the article.^[1].

5'-GGGAAUUCCGCGUGUGCUACGUAUCUUCAGGCGGUAACUAACUGUGCUGAGUCUAAUCUUUGUGAGGGACGGUAACAUAUGGUUCCCGCGUGGUCCGUUCGGGAUCCUC-3'

Ligand information

SELEX ligand

Transfer RNA (abbreviated tRNA and formerly referred to as sRNA, for soluble RNA) is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes), that serves as the physical link between the mRNA and the amino acid sequence of proteins. Transfer RNA (tRNA) does this by carrying an amino acid to the protein-synthesizing machinery of a cell called the ribosome. Complementation of a 3-nucleotide codon in a messenger RNA (mRNA) by a 3-nucleotide anticodon of the tRNA results in protein synthesis based on the mRNA code. As such, tRNAs are a necessary component of translation, the biological synthesis of new proteins in accordance with the genetic code.-----From Rfam

Some isolated sequences bind to the affinity of the nucleic acid.

Similar compound(s)

Researchers generate a mapping between European Nucleotide Archive (ENA), Protein Data Bank (PDB) and Rfam coordinate systems for those sequences which have a structure in the PDB. The ENA provides a comprehensive record of the world’s nucleotide sequencing information, covering raw sequencing data, sequence assembly information and functional annotation. It is calculated based on a comparison between the score of the alignment sequence and the expected score of the random model. A higher Bit score means that the comparison results are more similar and likely to be more reliable. The list of neighbours is sorted by Bit score.

Bit score is a relative score used to measure the similarity of a sequence alignment.

References