B4-25 aptamer, CB-42 aptamer

•

横向排列的点击按钮

Description

 In 1990, Andrew D. Ellington & Jack W. Szostak isolated RNA binding to some dyes through in vitro selection experiments, and named these RNA specifically binding as aptamers. Subpopulations of RNA molecules that bind specifically to a variety of organic dyes have been isolated from a population of random sequence RNA molecules. Started the earliest example of aptamer selection[1].

SELEX

Andrew D. Ellington & Jack W. Szostak used the in vitro selection system to isolate RNAs that bind to several dyes that appear to mimic metabolic cofactors. After the sixth round of selection, sequenced 17 clones from the CB(Cibacron Blue 3GA) pool, three of which were identical, and 14 clones from the B4(Reactive Blue 4) pool, all of which were different[1].
Detailed information are accessible on SELEX page.



Structure

The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. In addition, an analytical affinity column was run under isocratic conditions to determine an approximate dissociation constant (Kd) for the RNA-ligand interaction. The 2D structure of the left figure is based on the literature, and the right figure is based on the prediction results of the RNA fold website. We used the minimum free energy (MFE) structure[1].

B4-25 aptamer: 5'-GGGAGAAUUCCCGCGGCGUUGGCCCAGGAUAAUAGGACGAAAUCCGAAAAAUCCGUACCCAACAUAGAACCCCCCCAGCGCUCACACGGACGCCCCAUUACGGCUAACCGAACGCCUGCAGCCCGGGAAGCUU-3'
CB-42 aptamer: 5'-GGGAGAAUUCCCGCGGCAGAAGCCCACCUGGCUUUGAACUCUAUGUUAUUGGGUGGGGGAAACUUAAGAAAACUACCACCCUUCAACAUUACCGCCCUUCAGCCUGCCAGCGCCCUGCAGCCCGGGAAGCUU-3'
drawing drawing


Ligand information

SELEX ligand

Reactive Blue 4 (CAS# 13324-20-4) is an organic dye used in textiles. Reactive Blue 4 is water-soluble and a pollutant, and has been decolourized in water using microbial fuel cells, Dyes and metabolites.-----From MedChemExpress
Cibacron Blue 3G-A is an anthraquinone dye, inhibits the R46 β-lactamase with a Ki value of 1.2 uM.-----From MedChemExpress

Name Molecular Formula MW CAS Solubility MedChemExpress
Reactive Blue 4 C23H14Cl2N6O8S2 637.4 g/mol 13324-20-4 80g/L(at 20°C, water) HY-125815
Cibacron Blue 3GA C29H20ClN7O11S3 774.16 g/mol 84166-13-2 62.5g/L(in DMSO) HY-129042
drawing

Similar compound

We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.
Source ligand Zinc_id Named CAS pubchem CID Structure
Reactive Blue 4 ZINC000066076201 Vilmafix Blue A-R NA 167524 drawing
Reactive Blue 4 ZINC000027328433 PSB-10211 NA 53308119 drawing
Reactive Blue 4 ZINC000049888955 3-[(4-Amino-9,10-dioxo-3-sulfoanthracen-1-yl)amino]-5-[(4,6-dichloro-1,3,5-triazin-2-yl)amino]benzoic acid NA 25124828 drawing
Reactive Blue 4 ZINC000049899400 1-Amino-4-[4-[(4-chloro-6-methoxy-1,3,5-triazin-2-yl)amino]-3-sulfoanilino]-9,10-dioxoanthracene-2-sulfonic acid NA 25123183 drawing
Reactive Blue 4 ZINC000066099004 1-amino-4-[3-[(4,6-dioxo-1H-1,3,5-triazin-2-yl)amino]-4-sulfoanilino]-9,10-dioxoanthracene-2-sulfonic acid NA 53319011 drawing
Cibacron Blue 3GA not in ZINC Reactive Blue 2 79241-87-5 656725 drawing
Cibacron Blue 3GA not in ZINC Reactive Blue 5 16823-51-1 85599 drawing
Cibacron Blue 3GA not in ZINC Azure KX 4499-01-8 78253 drawing
Cibacron Blue 3GA not in ZINC Reactive Blue 2 NA 9875920 drawing
Cibacron Blue 3GA not in ZINC PSB-10211 NA 53308119 drawing


References

[1] In vitro selection of RNA molecules that bind specific ligands.
Ellington, A. D., & Szostak, J. W.
Nature, 346(6287), 818–822. (1990)