LR06(GA) aptamer

Apr 5, 2024 • Ke Chen, Yangyi Ren

Timeline

Description

In 1999, Ducongé F et al. used in vitro selecting techniques to isolate aptamers with high affinity binding TAR RNA sites. This 59-nt imperfect stem-loop is at the 5' end of HIV-1 transcriptIn. In 2007, Lebars I et al. used NMR systems and molecular dynamics methods to determine the structure of the complex formed by the LNA-modified aptamer and TAR RNA^[2,10].

SELEX

The in vitro selection experiment designed by Ducongé F and colleagues in 1999 mainly consisted of RNA pool ampplification and subsequent selection processes. RNAs were obtained by in vitro transcription of the PCR-amplified library with T7 RNA polymerase. The aptamer with high affinity was selected by eight rounds and the washing times were increased in the sixth to eighth rounds^[2].
Detailed information are accessible on SELEX page.

Structure

2D representation

Here we used ribodraw to complete the figure, through the 3D structure information. LR06(GA) was the aptamer sequence mainly studied in the article where structural selecting is performed^[10].

5'-CACGGUCCCAGACGUG-3'

3D visualisation

Lebars I and colleagues present the solution structure of TAR/LR06(GA) complex, as determined by heteronuclear NMR spectroscopy and molecular dynamics calculations. Structures were calculated using CNS (cristallography and NMR system) torsion angle molecular dynamics (TAMD) protocol for nucleic acids using NOE and dihedral angle restraints. In the figure, the TAR RNA sequence is labeled in forest, the LR06(GA) sequence is labeled in cyan, and the interacting bases in the two sequences are labeled in magenta. The PDB ID of this structure is 2OOM^[10].
Additional available structures that have been solved and detailed information are accessible on Structures page.

Binding pocket

Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 2OOM by NMR. TAR RNA (shown in surface) is labeled in gray. Right: The hydrogen bonds of binding sites of the aptamer bound with TAR RNA.

Ligand information

SELEX ligand

Lebars I and colleagues characterized the loop-loop complexes using thermal denaturation experiments monitored by UV spectroscopy. Subsequently, they determined the affinity between LR06(GA) and TAR RNA by SPR method. At the same time, the affinity between the LNA-modified aptamer and TAR RNA was also determined. These methods were employed to comprehensively assess the stability and affinity of different aptamers interaction under different experimental conditions, allowing for a robust evaluation of the binding affinity and dynamics between RNA aptamer and TAR RNA in varied environments^[10].

Structure ligand

The HIV trans-activation response (TAR) element is an RNA element which is known to be required for the trans-activation of the viral promoter and for virus replication. The TAR hairpin is a dynamic structure that acts as a binding site for the Tat protein, and this interaction stimulates the activity of the long terminal repeat promoter.-----From Rfam

Mirbase ID	Rfam	MW	Sequence	PDB ID
MI0007073	RF00250	9.31 kDa	GGCAGAUCUGAGCCUGGGAGCUCUCUGCC	1ANR

References

[1] DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes.
Boiziau, C., Dausse, E., Yurchenko, L., & Toulmé, J. J. 
J Biol Chem, 274(18), 12730-7. (1999)
[2] In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1.
Ducongé F., & Toulmé, J. J.
RNA, 5(12), 1605-14. (1999)
[3] NMR characterization of a kissing complex formed between the TAR RNA element of HIV-1 and a DNA aptamer.
Collin, D., van Heijenoort, C., Boiziau, C., Toulmé, J. J., & Guittet, E.
Nucleic Acids Res, 28(17), 3386–3391. (2000)
[4] Driving in vitro selection of anti-HIV-1 TAR aptamers by magnesium concentration and temperature.
Darfeuille, F., Sekkai, D., Dausse, E., Kolb, G., Yurchenko, L., Boiziau, C., & Toulmé, J. J.
Comb Chem High Throughput Screen, 5(4), 313-25. (2002)
[5] Molecular dynamics reveals the stabilizing role of loop closing residues in kissing interactions: comparison between TAR-TAR* and TAR-aptamer.
Beaurain, F., Di Primo, C., Toulmé, J. J., & Laguerre, M.
Nucleic Acids Res, 31(14), 4275-84. (2003)
[6] LNA/DNA chimeric oligomers mimic RNA aptamers targeted to the TAR RNA element of HIV-1.
Darfeuille, F., Hansen, J. B., Orum, H., Di Primo, C., & Toulmé, J. J.
Nucleic Acids Res, 32(10), 3101–3107. (2004)
[7] Hexitol nucleic acid-containing aptamers are efficient ligands of HIV-1 TAR RNA.
Kolb, G., Reigadas, S., Boiziau, C., van Aerschot, A., Arzumanov, A., Gait, M. J., Herdewijn, P., & Toulmé, J. J.
Biochemistry, 44(8), 2926-33. (2005)
[8] Bimodal loop-loop interactions increase the affinity of RNA aptamers for HIV-1 RNA structures.
Boucard, D., Toulmé, J. J., & Di Primo, C.
Biochemistry, 45(5), 1518-24. (2006)
[9] SELEX and dynamic combinatorial chemistry interplay for the selection of conjugated RNA aptamers.
Bugaut, A., Toulmé, J. J., & Rayner, B.
Org Biomol Chem, 4(22), 4082-8. (2006)
[10] NMR structure of a kissing complex formed between the TAR RNA element of HIV-1 and a LNA-modified aptamer.
Lebars, I., Richard, T., Di Primo, C., & Toulmé, J. J.
Nucleic Acids Res, 35(18), 6103-14. (2007)
[11] Exploring TAR–RNA aptamer loop–loop interaction by X-ray crystallography, UV spectroscopy and surface plasmon resonance.
Lebars, I., Legrand, P., Aimé, A., Pinaud, N., Fribourg, S., & Di Primo, C.
Nucleic Acids Res, 36(22), 7146-56. (2008)
[12] In vitro selection of RNA aptamers derived from a genomic human library against the TAR RNA element of HIV-1.
Watrin, M., Von Pelchrzim, F., Dausse, E., Schroeder, R., & Toulmé, J. J.
Biochemistry, 48(26), 6278-84. (2009)