RBA-14 aptamer

•

横向排列的点击按钮

Timeline

1993

Lori Giver obtained a series of aptamers with good affinity to HIV-1 Rev protein through in vitro selecting[1]

1993

Lori Giver found a short helical stem and bulged nucleotides (nt) CUC ... UYGAG that have no counterpart in the wild-type (wt) element contribute to high-affinity binding[2]

1994

The 3D model explains why RNA aptamer can bind Rev protein better[3]

1996

Aptamers were found to be functionally equivalent to the RBE when the assay system was saturated with Rev and better than the wild-type element when Rev was limiting[4]

1998

Specific inhibition of viral p24 production following co-transfection of the anti-HIV Rev-binding aptamer and HIV proviral DNAs was observed[6]

2004

More than half of the residues have increased flexibility in the Rev-RNA aptamer complex that has a higher affinity. This further suggests that the retention of conformational flexibility may be important in high-affinity ARM-RNA recognition[7]

2018

Altaira D. Dearborn et al. present the crystal structure of Rev93:scFv:RBA-14 Ternary Complex at 3.0 Å through X-ray[8]

Description

 In 1993, Lori Giver and colleagues used the SELEX method to isolate the aptamer with high compatibility for the HIV-1 Rev protein. Afterwards, in 2018, Altaira D. Dearborn et al. determined the X-ray crystal structure of an RNA aptamer (RBA-14), bound to a C-terminally truncated variant of Rev (Rev93), and a single-chain variable fragment antibody (scFv) crystallization chaperone[1,8].

SELEX

In 1993, Lori Giver et al. constructed a pool of random sequences. After in vitro selecting in the pool, selected RNAs were amplified via reverse transcription, polymerase chain reaction (PCR) amplification, in vitro T7 transcription, and allowed to again compete for binding to Rev. Some aptamers with high affinity were selected after three selection cycles[1].
Detailed information are accessible on SELEX page.



Structure

2D representation

Here we use ribodraw to complete the figure, through the 3D structure information. RBA-14 was the aptamer sequence mainly studied in SELEX article[8].

5'-GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC-3'

 drawing

3D visualisation

Altaira D. Dearborn et al. present the crystal structure of Rev93:scFv:RBA-14 Ternary Complex at 3.0 Å through X-ray. They used Rev:scFv as a crystallization platform for studying nucleic acid binding and made a ternary complex of Rev93, scFv and RBA-14, where the single-chain antibody functions as an assembly inhibitor, crystallization chaperone, and initial model for molecular replacement. The PDB ID of this structure is 6CF2[8].
Additional available structures that have been solved and detailed information are accessible on Structures page.

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar




Binding pocket

Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 6CF2. Rev93 protein (shown in vacuumm electrostatics), blue is positive charge, red is negative charge. Right: The hydrogen bonds of binding sites of the aptamer bound with Rev93 protein.

drawing drawing


Ligand information

SELEX ligand

Altaira D. Dearborn et al. determined the affinity of RBA-14 and Rev by surface plasmon resonance (SPR) method, and also compared the affinity of Rev with hairpins with Stem IIB sequences. SPR was performed on a Biacore ×100 (GE Healthcare), in 30 μL/minute HBS-EP+ buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 7.4, 150 mM sodium chloride, 3 mM ethylenediaminetetraacetic acid, 0.05% polysorbate 20) (GE Healthcare) at 25°C[8].

Name Sequence Ligand Affinity
RBA-14 GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC Rev93 5.9 nM
Stem IIB CCUGGGCGCAGUGUCAUUGACGCUGACGGUACAGG Rev93 12.9 nM

Structure ligand

Rev is a transactivating protein that is essential to the regulation of HIV-1 protein expression. A nuclear localization signal is encoded in the rev gene, which allows the Rev protein to be localized to the nucleus, where it is involved in the export of unspliced and incompletely spliced mRNAs. In the absence of Rev, mRNAs of the HIV-1 late (structural) genes are retained in the nucleus, preventing their translation.-----From Pfam
Uniprot ID Pfam MW Amino acids sequences PDB ID GenBank
P04616 PF00424 3.22 kDa GAMATRQARRNRRRRWRERQRAAAAR (residues T34-R50) 2M1A AAA44200.1
drawing

Similar compound

We used the RCSB PDB website's similar structure search to find the top 10 structures similar to HIV-1 Rev protein (residues T34-R50), and calculated TM-socre values and RMSD values used the TM-align website.
PDB TM-score RMSD Description
2LD2 0.358 0.89 Solution structure of the N-terminal domain of huntingtin (htt17) in presence of DPC micelles
1DNG 0.442 1.68 NMR structure of a model hydrophilic amphipathic helical acidic peptide
3N95-E 0.034 1.7 Crystal structure of human CRFR2 alpha extracellular domain in complex with Urocortin 2
1OMQ 0.366 1.1 Structure of penetratin in bicellar solution
7LSO 0.44 0.67 L-Phenylseptin
2RLG 0.34 0.79 NMR structure of the antimicrobial peptide RP-1 bound to SDS micelles
3N93-E 0.03 1.62 Crystal structure of human CRFR2 alpha extracellular domain in complex with Urocortin 3
7LSP 0.465 0.56 D-Phenylseptin - The second residue of PHE of the peptide is a D-amino acid
1O53 0.371 0.49 Solution structure of the N-terminal membrane anchor of E. coli enzyme IIA(Glucose)
6GS9 0.303 1.36 NMR structure of aurein 2.5 in SDS micelles


References

[1] Selective optimization of the Rev-binding element of HIV-1.
Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D.
Nucleic acids research, 21(23), 5509–5516. (1993)
[2] Selection and design of high-affinity RNA ligands for HIV-1 Rev.
Giver, L., Bartel, D. P., Zapp, M. L., Green, M. R., & Ellington, A. D.
Gene, 137(1), 19–24. (1993)
[3] A three-dimensional model of the Rev-binding element of HIV-1 derived from analyses of aptamers.
Leclerc, F., Cedergren, R., & Ellington, A. D.
Nature structural biology, 1(5), 293–300. (1994)
[4] RNA aptamers selected to bind human immunodeficiency virus type 1 Rev in vitro are Rev responsive in vivo.
Symensma, T. L., Giver, L., Zapp, M., Takle, G. B., & Ellington, A. D.
Journal of virology, 70(1), 179–187. (1996)
[5] Deep penetration of an alpha-helix into a widened RNA major groove in the HIV-1 rev peptide-RNA aptamer complex.
Ye, X., Gorin, A., Ellington, A. D., & Patel, D. J.
Nature structural biology, 3(12), 1026–1033. (1996)
[6] Receptor ligand-facilitated cationic liposome delivery of anti-HIV-1 Rev-binding aptamer and ribozyme DNAs.
Konopka, K., Düzgüneş, N., Rossi, J., & Lee, N. S.
Journal of drug targeting, 5(4), 247–259. (1998)
[7] Retention of conformational flexibility in HIV-1 Rev-RNA complexes.
Wilkinson, T. A., Zhu, L., Hu, W., & Chen, Y. 
Biochemistry, 43(51), 16153–16160. (2004)
[8] Structure of an RNA Aptamer that Can Inhibit HIV-1 by Blocking Rev-Cognate RNA (RRE) Binding and Rev-Rev Association.
Dearborn, A. D., Eren, E., Watts, N. R., Palmer, I. W., Kaufman, J. D., Steven, A. C., & Wingfield, P. T.
Structure (London, England : 1993), 26(9), 1187–1195.e4.  (2018)