SRB-2 aptamer

•

横向排列的点击按钮

Timeline

1998

Two aptamers that recognize the fluorophore sulforhodamine B were isolated by the in vitro selection process[1]

2009

How SRB-2 RNA aptamer-fluorophore complexes can be simultaneously structurally and photophysically characterized by FCS was demonstrates[2]

2013

An alternative approach based on contact quenching of fluorophores and fluorophore-binding aptamers (inculde SRB-2) to image RNA with small molecules in living cells was presented[3]

2015

Combining contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA aptamer) and SRB-2 aptamers allowed dual-colour imaging of two different fluorescence-enhancing RNA tags in living cells[4]

2018

A novel, bright, orange fluorescent turn-on probe based on SBR-2 with low background fluorescence, enabling live-cell RNA imaging was rationally designed[5]

2020

The concept of a cell-permeable fluorogenic dimer of self-quenched sulforhodamine B dyes and the corresponding dimerized aptamer that can enhance performance of the current RNA imaging method was propose[6]

Description

 In 1998, Leslie A Holeman et al. employed in vitro selection techniques to isolate aptamers with high-affinity binding sites for sulforhodamine B. The aptamer binds the fluorophore with high affinity, recognizing both the planar aromatic ring system and a negatively charged sulfonate, a rare example of anion recognition by RNA[1].

SELEX

SELEX was performed with a library containing ~5×1014 random RNA molecules and selected RNAs for their ability to bind Sulforhodamine agarose. After SELEX, researchers selected a number of sequences, including SRB-1 and SRB-2, to characterize their affinity for the dye and its spectral properties[1].
Detailed information are accessible on SELEX page.



Structure

The 2D structure of the figure is based on the article by ribodraw tool to draw[1].

5'-GGAACACUAUCCGACUGGCACCUGUGCUCUAUAGCAGAAUGCUAACAUUAGAUGAUGGAGGGGCGCAAGGUUAACCGCCUCAGUACAUCGGUGCCUUGGUCAUUAGGAUCCCG-3'

 drawing

Ligand information

SELEX ligand

Sulforhodamine B or Kiton Red 620 is a fluorescent dye with uses spanning from laser-induced fluorescence (LIF) to the quantification of cellular proteins of cultured cells. This red solid dye is very water-soluble.-----From Wikipedia
Name Molecular Formula MW CAS Solubility PubChem Drug ID
Sulforhodamine B C27H30N2O7S2 558.7 g/mol 2609-88-3 50 mg/mL in H2O, 62.5 mg/mL in DMSO 65191 HY-D0974
drawing

Similar compound

We screened the compounds with great similarity by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID.
Zinc_id Named CAS Pubchem CID Structure
ZINC4235524 Sulforhodamine B 2609-88-3 65191 drawing
ZINC95713114 Xanthylium 62796-29-6 65224 drawing
ZINC3874033 [4-[[4-(diethylamino)phenyl]-(2,4-disulfophenyl)methylidene]cyclohexa-2,5-dien-1-ylidene]-diethylazanium 129-17-9 8508 drawing
ZINC4365621 Carmine Blue V/Solar Pure Blue VX 20262-76-4 77074 drawing
ZINC80902125 (4-(3,6-Bis(diethylamino)-9H-xanthen-9-yl)benzene-1,3-disulphonic acid) 85681-99-8 3020898 drawing


References

[1] Isolation and characterization of fluorophore-binding RNA aptamers.
Holeman, L. A., Robinson, S. L., Szostak, J. W., & Wilson, C.
Folding & design, 3(6), 423–431. (1998)
[2] Characterization of a fluorophore binding RNA aptamer by fluorescence correlation spectroscopy and small angle X-ray scattering.
Werner, A., Konarev, P. V., Svergun, D. I., & Hahn, U.
Analytical biochemistry, 389(1), 52–62. (2009)
[3] Contact-Mediated Quenching for RNA Imaging in Bacteria with a Fluorophore-Binding Aptamer.
Sunbul, M., & Jäschke, A.
Angewandte Chemie, 52(50), 13401–13404. (2013)
[4] Dual-colour imaging of RNAs using quencher- and fluorophore-binding aptamers.
Arora, A., Sunbul, M., & Jäschke, A.
Nucleic acids research, 43(21), e144. (2015)
[5] SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging.
Sunbul, M., & Jäschke, A.
Nucleic acids research, 46(18), e110. (2018)
[6] A dimerization-based fluorogenic dye-aptamer module for RNA imaging in live cells.
Bouhedda, F., Fam, K. T., Collot, M., Autour, A., Marzi, S., Klymchenko, A., & Ryckelynck, M.
Nature chemical biology, 16(1), 69–76. (2020)