Home
Database
Research
About us
rafl7s aptamer
Description
In 2000, Jhaveri, S., Rajendran, M., & Ellington, A. D screened aptamers capable of binding to ATP and emitting fluorescent signals from a pool of RNA molecules enriched in fluorescein-labelled uridine by in vitro selection (in vitro selection). Through a series of screening and amplification steps, the aptamer that specifically binds to ATP and produces fluorescence changes is finally selected[1].SELEX
In 2000, Jhaveri, S., Rajendran, M., & Ellington, A. D isolated RNA binding to some ATP through in vitro selection experiments[1].
Detailed information are accessible on SELEX page.
Structure
The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. In addition, an analytical affinity column was run under isocratic conditions to determine an approximate dissociation constant (Kd) for the RNA-ligand interaction. The 2D structure of the figure is based on the article by ribodraw tool to draw.5′GGAAGGCACGACGAAGCAAGCAGGCAACGAACACAGAAGACCGGGGGAACUACCGCGCGCGCCAGACCCAACCAGCCAGAGACC3′
Ligand information
SELEX ligand
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.-----From drugbank.
| Name | Molecular Formula | MW | CAS | Solubility | PubChem | Drug ID |
|---|---|---|---|---|---|---|
| ATP | C10H16N5O13P3 | 507.18 g/mol | 56-65-5 | 1000.0 mg/mL | 5957 | DB00171 |
Similar compound
We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.
| Zinc_id | Named | CAS | Pubchem CID | Structure |
|---|---|---|---|---|
| ZINC000002126310 | Vidarabine Phosphate | 29984-33-6 | 34768 |  |
| ZINC000053684016 | Alpha-Methylene Adenosine Monophosphate | nan | 46936495 |  |
| ZINC000053684213 | 6-Chloropurine Riboside, 5'-Monophosphate | nan | 70789235 |  |
| ZINC000004096488 | 6-Thioinosine-5'-Monophosphate | 53-83-8 | 3034391 |  |
| ZINC000013543089 | 6-Methylthiopurine 5'-Monophosphate Ribonucleotide | 7021-52-5 | 3037883 |  |
| ZINC000003927870 | Fludarabine | 21679-14-1 | 657237 |  |
| ZINC000013543718 | Vidarabine Phosphoric Acid | nan | 22840996 |  |
| ZINC000001631259 | 3'-Adenylic acid | 84-21-9 | 41211 |  |
References
[1] In vitro selection of signaling aptamers.Jhaveri, S., Rajendran, M., & Ellington, A. D.
Nature biotechnology, 18(12), 1293–1297. (2000)