rafl7s aptamer



Description

In 2000, Jhaveri, S., Rajendran, M., & Ellington, A. D screened aptamers capable of binding to ATP and emitting fluorescent signals from a pool of RNA molecules enriched in fluorescein-labelled uridine by in vitro selection (in vitro selection). Through a series of screening and amplification steps, the aptamer that specifically binds to ATP and produces fluorescence changes is finally selected[1].


SELEX

In 2000, Jhaveri, S., Rajendran, M., & Ellington, A. D isolated RNA binding to some ATP through in vitro selection experiments[1].
Detailed information are accessible on SELEX page.



Structure

The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. In addition, an analytical affinity column was run under isocratic conditions to determine an approximate dissociation constant (Kd) for the RNA-ligand interaction. The 2D structure of the figure is based on the article by ribodraw tool to draw.

5′GGAAGGCACGACGAAGCAAGCAGGCAACGAACACAGAAGACCGGGGGAACUACCGCGCGCGCCAGACCCAACCAGCCAGAGACC3′

drawing


Ligand information

SELEX ligand

An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.-----From drugbank.

Name Molecular Formula MW CAS Solubility PubChem Drug ID
ATP C10H16N5O13P3 507.18 g/mol 56-65-5 1000.0 mg/mL 5957 DB00171
drawing


Similar compound

We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.

Zinc_id Named CAS Pubchem CID Structure
ZINC000002126310 Vidarabine Phosphate 29984-33-6 34768 drawing
ZINC000053684016 Alpha-Methylene Adenosine Monophosphate nan 46936495 drawing
ZINC000053684213 6-Chloropurine Riboside, 5'-Monophosphate nan 70789235 drawing
ZINC000004096488 6-Thioinosine-5'-Monophosphate 53-83-8 3034391 drawing
ZINC000013543089 6-Methylthiopurine 5'-Monophosphate Ribonucleotide 7021-52-5 3037883 drawing
ZINC000003927870 Fludarabine 21679-14-1 657237 drawing
ZINC000013543718 Vidarabine Phosphoric Acid nan 22840996 drawing
ZINC000001631259 3'-Adenylic acid 84-21-9 41211 drawing


References

[1] In vitro selection of signaling aptamers.
Jhaveri, S., Rajendran, M., & Ellington, A. D.
 Nature biotechnology, 18(12), 1293–1297. (2000)